Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30026
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Bourbigot, S.; Dock-Bregeon, A.C.; Eberling, P.; Coutant, J.; Kieffer, B.; Lebars, I.. "Solution structure of the 5'-terminal hairpin of the 7SK small nuclear RNA
" RNA 22, 1844-1858 (2016).
PubMed: 27852926
Assembly members:
RNA (57-MER), polymer, 57 residues, 18268.777 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
RNA (57-MER): GGGAUCUGUCACCCCAUUGA
UCGCCUUCGGGCUGAUCUGG
CUGGCUAGGCGGGUCCC
| Data type | Count |
| 13C chemical shifts | 68 |
| 15N chemical shifts | 23 |
| 1H chemical shifts | 256 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
Entity 1, entity_1 57 residues - 18268.777 Da.
| 1 | G | G | G | A | U | C | U | G | U | C | ||||
| 2 | A | C | C | C | C | A | U | U | G | A | ||||
| 3 | U | C | G | C | C | U | U | C | G | G | ||||
| 4 | G | C | U | G | A | U | C | U | G | G | ||||
| 5 | C | U | G | G | C | U | A | G | G | C | ||||
| 6 | G | G | G | U | C | C | C |
sample_1: HPI 0.8 mM; HPI, [U-99% 13C; U-99% 15N], 0.4 mM; HPI, [U-13C; U-15N]-Ade, 0.4 mM; HPI, [U-13C; U-15N]-Cyt, 0.4 mM; HPI, [U-13C; U-15N]-Gua, 0.4 mM; HPI, [U-13C; U-15N]-Ura, 0.4 mM; H2O 90%; D2O 10%
sample_2: HPI 0.8 mM; HPI, [U-99% 13C; U-99% 15N], 0.4 mM; HPI, [U-13C; U-15N]-Ade, 0.4 mM; HPI, [U-13C; U-15N]-Cyt, 0.4 mM; HPI, [U-13C; U-15N]-Gua, 0.4 mM; HPI, [U-13C; U-15N]-Ura, 0.4 mM; D2O 100%
sample_3: HPI, [U-13C; U-15N]-Ade, 0.4 mM; HPI, [U-13C; U-15N]-Gua, 0.4 mM; HPI, [U-13C; U-15N]-Ura, 0.4 mM; H2O 90%; D2O 10%
sample_conditions_1: ionic strength: 50 mM; pH: 6.4; pressure: 101325 Pa; temperature: 288 K
sample_conditions_2: ionic strength: 50 mM; pH: 6.4; pressure: 101325 Pa; temperature: 303 K
sample_conditions_3: ionic strength: 50 mM; pH: 6.4; pressure: 101325 Pa; temperature: 303 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_2 |
| 2D 1H-13C HSQC | sample_2 | isotropic | sample_conditions_2 |
| 2D 1H-13C HSQC | sample_3 | anisotropic | sample_conditions_3 |
| 2D 1H-1H TOCSY | sample_2 | isotropic | sample_conditions_2 |
| 2D DQF-COSY | sample_2 | isotropic | sample_conditions_2 |
| 3D HCCH-TOCSY | sample_2 | isotropic | sample_conditions_2 |
| 2D 1H-15N HSQC | sample_3 | anisotropic | sample_conditions_3 |
| 3D HCP | sample_2 | isotropic | sample_conditions_2 |
| 2D HPCOSY | sample_2 | isotropic | sample_conditions_2 |
| 2D HCN | sample_2 | isotropic | sample_conditions_2 |
CNS, Brunger A. T. et.al., Brunger, Adams, Clore, Gros, Nilges and Read - refinement, structure calculation
SPARKY, Goddard - chemical shift assignment, peak picking