Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30012
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Kerkour, Abdelaziz; Marquevielle, Julien; Ivashchenko, Stefaniia; Yatsunyk, Liliya; Mergny, Jean-Louis; Salgado, Gilmar. "High-resolution three-dimensional NMR structure of the KRAS proto-oncogene promoter reveals key features of a G-quadruplex involved in transcriptional regulation" J. Biol. Chem. 292, 8082-8091 (2017).
PubMed: 28330874
Assembly members:
DNA (5'-D(*AP*GP*GP*GP*CP*GP*GP*TP*GP*TP*GP*GP*GP*AP*AP*TP*AP*GP*GP*GP*AP*A)-3'), polymer, 22 residues, 6986.514 Da.
POTASSIUM ION, non-polymer, 39.098 Da.
Natural source: Common Name: human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: homo not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
DNA (5'-D(*AP*GP*GP*GP*CP*GP*GP*TP*GP*TP*GP*GP*GP*AP*AP*TP*AP*GP*GP*GP*AP*A)-3'): AGGGCGGTGTGGGAATAGGG
AA
Data type | Count |
1H chemical shifts | 218 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | entity_1 | 1 |
2 | potassium ion | 2 |
Entity 1, entity_1 22 residues - 6986.514 Da.
1 | DA | DG | DG | DG | DC | DG | DG | DT | DG | DT | ||||
2 | DG | DG | DG | DA | DA | DT | DA | DG | DG | DG | ||||
3 | DA | DA |
Entity 2, potassium ion - 39.098 Da.
1 | K |
sample_1: KRAS 22RT 2 mM; KRAS 22RT 15N, dG (5% 15N), 2 mM; H2O 90%; D2O 10%
sample_conditions_1: ionic strength: 90 mM; pH: 6.6; pressure: 1 atm; temperature: 293 K
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H COSY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
2D 1H-13C HMBC | sample_1 | isotropic | sample_conditions_1 |
1D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
AMBER, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement
ARIA, Linge, O'Donoghue and Nilges - structure calculation
CNS, Brunger, Adams, Clore, Gros, Nilges and Read - structure calculation
CcpNMR, CCPN - data analysis
SPARKY, Goddard - chemical shift assignment
TOPSPIN, Bruker Biospin - collection