Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR26842
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Duchardt-Ferner, Elke; Juen, Michael; Kreutz, Christoph; Wohnert, Jens. "NMR resonance assignments for the tetramethylrhodamine binding RNA aptamer 3 in complex with the ligand 5-carboxy-tetramethylrhodamine
" Biomol. NMR Assign. 11, 29-34 (2017).
PubMed: 27730489
Assembly members:
TMR-3_48nt, polymer, 48 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: reverse transcriptase Host organism: Escherichia coli
Entity Sequences (FASTA):
TMR-3_48nt: GGACGACUGAACCGAAAGGU
UCUUGGCUGCUUCGGCAGAG
GUACGUCC
| Data type | Count |
| 13C chemical shifts | 382 |
| 15N chemical shifts | 157 |
| 1H chemical shifts | 415 |
| 31P chemical shifts | 3 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | TMR-3_48nt | 1 |
Entity 1, TMR-3_48nt 48 residues - Formula weight is not available
| 1 | G | G | A | C | G | A | C | U | G | A | ||||
| 2 | A | C | C | G | A | A | A | G | G | U | ||||
| 3 | U | C | U | U | G | G | C | U | G | C | ||||
| 4 | U | U | C | G | G | C | A | G | A | G | ||||
| 5 | G | U | A | C | G | U | C | C |
unlabeled_sample: TMR-3_48nt 1.2 ± 0.1 mM; 5-Carboxy-Tetramethylrhodamine 1.4 ± 0.2 mM; D2O 5 v/v; sodium chloride 10 mM; Na-Glutamate 130 mM; H2O 95 v/v
13C-15N_sample: TMR-3_48nt, [U-13C; U-15N], 1.2 ± 0.1 mM; 5-Carboxy-Tetramethylrhodamine 1.4 ± 0.2 mM; D2O 5 v/v; H2O 95 v/v; sodium chloride 10 mM; Na-Glutamate 130 mM
15N_sample: TMR-3_48nt, [U-15N], 1.2 ± 0.1 mM; 5-Carboxy-Tetramethylrhodamine 1.4 ± 0.2 mM; D2O 5 v/v; H2O 95 v/v; sodium chloride 10 mM; K-glutamate 130 mM
A-C-13C-15N_sample_H2O: TMR-3_48nt, [U-13C; U-15N]-Ade,Cyt, 1.2 ± 0.1 mM; 5-Carboxy-Tetramethylrhodamine 1.4 ± 0.2 mM; D2O 5 v/v; H2O 95 v/v; sodium chloride 10 mM; K-glutamate 130 mM
G-U-13C-15N_sample_H2O: TMR-3_48nt, [U-13C; U-15N]-Gua,Ura, 1.2 ± 0.1 mM; 5-Carboxy-Tetramethylrhodamine 1.4 ± 0.2 mM; D2O 5 v/v; H2O 95 v/v; sodium chloride 10 mM; Na-Glutamate 130 mM
A-C-13C-15N_sample_D2O: TMR-3_48nt, [U-13C; U-15N]-Ade,Cyt, 1.2 ± 0.1 mM; 5-Carboxy-Tetramethylrhodamine 1.4 ± 0.2 mM; D2O 100 v/v; sodium chloride 10 mM; K-glutamate 130 mM
G-U-13C-15N_sample_D2O: TMR-3_48nt, [U-13C; U-15N]-Gua,Ura, 1.2 ± 0.1 mM; 5-Carboxy-Tetramethylrhodamine 1.4 ± 0.2 mM; D2O 100 v/v; sodium chloride 10 mM; Na-Glutamate 130 mM
283K: ionic strength: 0.41 M; pH: 7.5; pressure: 1 atm; temperature: 283 K
298K: ionic strength: 0.28 M; pH: 7.5; pressure: 1 atm; temperature: 283 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 3D 1H-13C NOESY aromatic | 13C-15N_sample | isotropic | 298K |
| 3D 1H-13C NOESY aliphatic | 13C-15N_sample | isotropic | 298K |
| 3D 1H-13C NOESY aromatic | A-C-13C-15N_sample_H2O | isotropic | 298K |
| 3D 1H-13C NOESY aliphatic | A-C-13C-15N_sample_D2O | isotropic | 298K |
| 3D 1H-13C NOESY aromatic | G-U-13C-15N_sample_H2O | isotropic | 298K |
| 3D 1H-13C NOESY aliphatic | G-U-13C-15N_sample_D2O | isotropic | 298K |
| 2D 1H-1H NOESY | 15N_sample | isotropic | 283K |
| 2D 1H-15N HSQC | 15N_sample | isotropic | 283K |
| 2D 1H-15N HSQC NH2 only | 15N_sample | isotropic | 283K |
| SELLR HNN-COSY | 15N_sample | isotropic | 298K |
| HNN-COSY | 15N_sample | isotropic | 298K |
| amino HNN-COSY | 15N_sample | isotropic | 298K |
| H1/H8 13C-HMBC | G-U-13C-15N_sample_H2O | isotropic | 298K |
| 2D H5(C5C4N3)H3 | G-U-13C-15N_sample_H2O | isotropic | 298K |
| 2D H5(C5C4N4)H4 | A-C-13C-15N_sample_H2O | isotropic | 298K |
| 2D H(C)N aromatic | A-C-13C-15N_sample_D2O | isotropic | 298K |
| 2D H(C)N aliphatic | A-C-13C-15N_sample_D2O | isotropic | 298K |
| 2D H(C)N aromatic | G-U-13C-15N_sample_D2O | isotropic | 298K |
| 2D H(C)N aliphatic | G-U-13C-15N_sample_D2O | isotropic | 298K |
| 3D HCCH-TOCSY | A-C-13C-15N_sample_D2O | isotropic | 298K |
| 3D HCCH-TOCSY | G-U-13C-15N_sample_D2O | isotropic | 298K |
| 3D HCCH-COSY | A-C-13C-15N_sample_D2O | isotropic | 298K |
| 3D HCCH-COSY | G-U-13C-15N_sample_D2O | isotropic | 298K |
| 2D H(N)CO | G-U-13C-15N_sample_H2O | isotropic | 298K |
| H6-C2/C4 lr13C-HSQC | unlabeled_sample | isotropic | 298K |
| H5-N3 lr15N-HSQC | G-U-13C-15N_sample_H2O | isotropic | 298K |
| TROSY relayed HCCH COSY | A-C-13C-15N_sample_D2O | isotropic | 298K |
| 2D H(C)P | A-C-13C-15N_sample_D2O | isotropic | 298K |
| 2D H(C)P | G-U-13C-15N_sample_D2O | isotropic | 298K |
TOPSPIN v3.2, Bruker Biospin - acquisition, processing
CARA, Keller and Wuthrich - chemical shift assignment