Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25784
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Barnwal, Ravi; Loh, Edmund; Godin, Kate; Yip, Jordan; Lavender, Hayley; Tang, Christoph; Varani, Gabriele. "Structure and mechanism of a molecular rheostat, an RNA thermometer that modulates immune evasion by Neisseria meningitidis
" Nucleic Acids Res. 44, 9426-9437 (2016).
PubMed: 27369378
Assembly members:
CssA_RNA_thermometer_(68-MER), polymer, 68 residues, 21654.873 Da.
Natural source: Common Name: b-proteobacteria Taxonomy ID: 487 Superkingdom: Bacteria Kingdom: not available Genus/species: Neisseria meningitidis
Experimental source: Production method: in vitro transcription
Entity Sequences (FASTA):
CssA_RNA_thermometer_(68-MER): GGAAUUUAUGAGUACGUAGA
GUAUAAUUAGUCUUCGGACU
UCCUUAUACUUAUAUACUUA
UAGAUUCC
| Data type | Count |
| 13C chemical shifts | 31 |
| 15N chemical shifts | 26 |
| 1H chemical shifts | 287 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | RNA (68-MER) | 1 |
Entity 1, RNA (68-MER) 68 residues - 21654.873 Da.
| 1 | G | G | A | A | U | U | U | A | U | G | ||||
| 2 | A | G | U | A | C | G | U | A | G | A | ||||
| 3 | G | U | A | U | A | A | U | U | A | G | ||||
| 4 | U | C | U | U | C | G | G | A | C | U | ||||
| 5 | U | C | C | U | U | A | U | A | C | U | ||||
| 6 | U | A | U | A | U | A | C | U | U | A | ||||
| 7 | U | A | G | A | U | U | C | C |
sample_1: CssA RNA thermometer (68-MER)0.4 1.1 mM; CssA RNA thermometer (68-MER), 13C/15N-uniformly labeled, 0.4 1.1 mM; CssA RNA thermometer (68-MER), 13C/15N-AU labeled, 0.4 1.1 mM; CssA RNA thermometer (68-MER), partially deuterated, 0.4 1.1 mM; H2O 95%; D2O 5%
sample_conditions_1: pH: 6.0; pressure: 1 atm; temperature: 273 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D DQF-COSY | sample_1 | isotropic | sample_conditions_1 |
| 3D HCCH-TOCSY | sample_1 | isotropic | sample_conditions_1 |
| 3D 1H-13C NOESY | sample_1 | isotropic | sample_conditions_1 |
| ARTSY | sample_1 | isotropic | sample_conditions_1 |
| ARTSY | sample_1 | anisotropic | sample_conditions_1 |
TOPSPIN, Bruker Biospin - collection, processing
NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - data analysis, processing
SPARKY, Goddard - chemical shift assignment, data analysis, peak picking
X-PLOR_NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure solution