Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25671
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Jain, Niyati; Morgan, Christopher; Rife, Brittany; Salemi, Marco; Tolbert, Blanton. "Solution Structure of the HIV-1 Intron Splicing Silencer and Its Interactions with the UP1 Domain of Heterogeneous Nuclear Ribonucleoprotein (hnRNP) A1
" J. Biol. Chem. 291, 2331-2344 (2016).
PubMed: 26607354
Assembly members:
RNA_(53-MER), polymer, 53 residues, 17006.127 Da.
Natural source: Common Name: HIV Taxonomy ID: 11676 Superkingdom: Viruses Kingdom: not available Genus/species: Lentivirus Human immunodeficiency virus 1
Experimental source: Production method: In vitro transcription Host organism: T7 dependent In vitro Transcription
Entity Sequences (FASTA):
RNA_(53-MER): GGAAUAUUUUUGCUGUACUU
UCUAUAGUGAAUAGAGUUAG
GCAGGGAUAUUCC
| Data type | Count |
| 1H chemical shifts | 172 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | RNA (53-MER) | 1 |
Entity 1, RNA (53-MER) 53 residues - 17006.127 Da.
| 1 | G | G | A | A | U | A | U | U | U | U | ||||
| 2 | U | G | C | U | G | U | A | C | U | U | ||||
| 3 | U | C | U | A | U | A | G | U | G | A | ||||
| 4 | A | U | A | G | A | G | U | U | A | G | ||||
| 5 | G | C | A | G | G | G | A | U | A | U | ||||
| 6 | U | C | C |
ISS_1: ISS (53-MER), [U-2H], 80 120 uM; D2O, natural abunance, 100%
ISS_2: ISS (53-MER), [U-2H], 80 120 uM; D2O, natural abunance, 100%
ISS_3: ISS (53-MER), [U-100% 13C], 80 120 uM; D2O, natural abunance, 100%
ISS_conditions_1: ionic strength: 10 mM; pH: 6.5; pressure: 1 atm; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | ISS_1 | isotropic | ISS_conditions_1 |
| 2D 1H-1H TOCSY | ISS_2 | isotropic | ISS_conditions_1 |
| 2D 1H-13C HMQC | ISS_3 | isotropic | ISS_conditions_1 |
NMRDraw, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing
NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing
X-PLOR_NIH, Schwieters, Kuszewski, Tjandra and Clore - structure solution
TOPSPIN, Bruker Biospin - collection
AMBER, Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement