Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25603
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Codutti, Luca; Leppek, Katrin; Zalesak, Jan; Windeisen, Volker; Masiewicz, Pawel; Stoecklin, Georg; Carlomagno, Teresa. "A Distinct, Sequence-Induced Conformation Is Required for Recognition of the Constitutive Decay Element RNA by Roquin
" Structure 23, 1437-1447 (2015).
PubMed: 26165594
Assembly members:
RNA_(5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*UP*CP*UP*GP*UP*GP*AP*AP*AP*AP*CP*GP*GP*UP*U)-3'), polymer, 23 residues, 7343.398 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
RNA_(5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*UP*CP*UP*GP*UP*GP*AP*AP*AP*AP*CP*GP*GP*UP*U)-3'): GCAUGUUUUCUGUGAAAACG
GUU
| Data type | Count |
| 13C chemical shifts | 148 |
| 15N chemical shifts | 33 |
| 1H chemical shifts | 185 |
| 31P chemical shifts | 21 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*UP*CP*UP*GP*UP*GP*AP*AP*AP*AP*CP*GP*GP*UP*U)-3') | 1 |
Entity 1, RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*UP*CP*UP*GP*UP*GP*AP*AP*AP*AP*CP*GP*GP*UP*U)-3') 23 residues - 7343.398 Da.
| 1 | G | C | A | U | G | U | U | U | U | C | ||||
| 2 | U | G | U | G | A | A | A | A | C | G | ||||
| 3 | G | U | U |
sample_1: RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*UP*CP*UP*GP*UP*GP*AP*AP*AP*AP*CP*GP*GP*UP*U)-3'), [U-100% 13C; U-100% 15N], 0.30 ± 0.05 mM; sodium phosphate 20 ± 5 mM; D2O, [U-100% 2H], 55 M
sample_2: RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*UP*CP*UP*GP*UP*GP*AP*AP*AP*AP*CP*GP*GP*UP*U)-3'), [U-100% 13C; U-100% 15N], 0.30 ± 0.05 mM; sodium phosphate 20 ± 5 mM
sample_3: RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*UP*CP*UP*GP*UP*GP*AP*AP*AP*AP*CP*GP*GP*UP*U)-3'), [U-100% 13C; U-100% 15N], 0.30 ± 0.05 mM; sodium phosphate 20 ± 5 mM; Pf1 phage 30 ± 5 mg/mL
sample_conditions_1: ionic strength: 20 mM; pH: 6.5; pressure: 1 atm; temperature: 300 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
| immino-1H-1H NOESY | sample_2 | isotropic | sample_conditions_1 |
| 3D-HCCH-COSY-TOCSY | sample_1 | isotropic | sample_conditions_1 |
| 3D HsCNb/HbCNb | sample_1 | isotropic | sample_conditions_1 |
| 2D HNN-COSY | sample_1 | isotropic | sample_conditions_1 |
| 3D 13C-edited NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D COSY | sample_1 | isotropic | sample_conditions_1 |
| 1H-31P HET-COR(P,H-COSY-H,C-HMQC) | sample_1 | isotropic | sample_conditions_1 |
| T1-13C-EDIT relaxation | sample_1 | isotropic | sample_conditions_1 |
| T1rho-13C-EDIT relaxation | sample_1 | isotropic | sample_conditions_1 |
| 13C-base edited IPAP | sample_3 | anisotropic | sample_conditions_1 |
| 13C-sugar edited IPAP | sample_3 | anisotropic | sample_conditions_1 |
CNS v1.1, Brunger, Adams, Clore, Gros, Nilges and Read - refinement, structure solution
TOPSPIN, Bruker Biospin - collection
CCPN_Analysis v2.3, CCPN - chemical shift assignment
ARIA v1.2, Linge, O'Donoghue and Nilges - refinement, structure solution