BMRB Entry 19435

Click here to enlarge.

PDB ID: 2mcc
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR19435
MolProbity Validation Chart

NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry

Title:
Structural studies on dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence
Deposition date:
2013-08-18
Original release date:
2013-09-30
Authors:
Williamson, Mike; Wilson, Tom; Thomas, James; Felix, Vitor; Costa, Paolo
Citation:

Citation: Wilson, Tom; Costa, Paulo; Felix, Vitor; Williamson, Mike; Thomas, Jim. "Structural Studies on Dinuclear Ruthenium(II) Complexes That Bind Diastereoselectively to an Antiparallel Folded Human Telomere Sequence."  J. Med. Chem. 56, 8674-8683 (2013).
PubMed: 24088028

Assembly members:

Assembly members:
human_telomere_quadruplex, polymer, 22 residues, 135.128 Da.
entity_RUL, non-polymer, 1211.268 Da.

Natural source:

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):

Entity Sequences (FASTA):
human_telomere_quadruplex: AGGGTTAGGGTTAGGGTTAG GG

Data sets:
Data typeCount
1H chemical shifts196

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1human telomere quadruplex1
2DD-bisRuthenium ligand2

Entities:

Entity 1, human telomere quadruplex 22 residues - 135.128 Da.

Folds to a basket G-quadruplex

1   DADGDGDGDTDTDADGDGDG
2   DTDTDADGDGDGDTDTDADG
3   DGDG

Entity 2, DD-bisRuthenium ligand - C64 H44 N14 Ru2 - 1211.268 Da.

1   RUL