Click here to enlarge.
PDB ID: 2l88
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17397
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Tong, Xiaotian; Lan, Wenxian; Zhang, Xu; Wu, Houming; Liu, Maili; Cao, Chunyang. "Solution structure of all parallel G-quadruplex formed by the oncogene RET promoter sequence." Nucleic Acids Res. 39, 6753-6763 (2011).
PubMed: 21540209
Assembly members:
RET_oncogene, polymer, 20 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis Host organism: Escherichia coli Vector: not applicable
Entity Sequences (FASTA):
RET_oncogene: GGGGCGGGGCGGGGCGGGGT
Data type | Count |
1H chemical shifts | 209 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | RET_oncogene | 1 |
Entity 1, RET_oncogene 20 residues - Formula weight is not available
1 | DG | DG | DG | DG | DC | DG | DG | DG | DG | DC | |
2 | DG | DG | DG | DG | DC | DG | DG | DG | DG | DT |