Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR15697
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Thiviyanathan, Varatharasa; Kulasegaran, Raghav; Kaluarachchi, Kumaralal; Rijnbrand, Rene; Gorenstein, David. "Mutational and Structural Analysis of Stem-loop IIId of the Hepatitis C Virus and
GB Virus B Internal Ribosome Entry Sites
" J. Virology ., .-..
Assembly members:
GBV_B_IRES, polymer, 22 residues, Formula weight is not available
Natural source: Common Name: GB virus B Taxonomy ID: 39113 Superkingdom: Viruses Kingdom: not available Genus/species: not available GB virus B
Experimental source: Production method: enzymatic synthesis Vector: n/a
Entity Sequences (FASTA):
GBV_B_IRES: GGAUGGUUGGGGUUAGCCAU
CC
| Data type | Count |
| 1H chemical shifts | 179 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | domain IIId | 1 |
Entity 1, domain IIId 22 residues - Formula weight is not available
| 1 | G | G | A | U | G | G | U | U | G | G | ||||
| 2 | G | G | U | U | A | G | C | C | A | U | ||||
| 3 | C | C |
sample_1: GBV_B_IRES 1.2 mM; potassium chloride 10 mM; sodium phosphate 10 mM; EDTA 0.05 mM
sample_conditions_1: ionic strength: 10 mM; pH: 6.8; pressure: 1 atm; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
| 2D DQF-COSY | sample_1 | isotropic | sample_conditions_1 |
VNMR, Varian - chemical shift assignment