Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR11607
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Otsu, Maina; Norose, Nao; Arai, Nao; Terao, Ryo; Kajikawa, Masaki; Okada, Norihiro; Kawai, Gota. "Solution structure of a reverse transcriptase recognition site of a LINE RNA from zebrafish
" .
Assembly members:
RNA_(34-MER), polymer, 34 residues, 10859.578 Da.
Natural source: Common Name: zebrafish Taxonomy ID: 7955 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Denio Renio
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
RNA_(34-MER): GGCGCUUUGACACAAUCUAC
AUUGUAAAAGCGCC
| Data type | Count |
| 13C chemical shifts | 33 |
| 1H chemical shifts | 97 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | RNA (34-MER) | 1 |
Entity 1, RNA (34-MER) 34 residues - 10859.578 Da.
| 1 | G | G | C | G | C | U | U | U | G | A | ||||
| 2 | C | A | C | A | A | U | C | U | A | C | ||||
| 3 | A | U | U | G | U | A | A | A | A | G | ||||
| 4 | C | G | C | C |
ZfL2-1-34_D2O: RNA (34-MER) 0.3 mM; RNA (34-MER), [U-100% 13C; U-100% 15N], 0.26 mM; sodium phosphate 20 mM; sodium chloride 50 mM; D2O, [U-2H], 100%
ZfL2-1-34_H2O: RNA (34-MER), [U-13C; U-15N]-Ade, 0.18 mM; RNA (34-MER), [U-13C; U-15N]-Gua, 0.19 mM; sodium phosphate 20 mM; sodium chloride 50 mM; H2O 95%; D2O, [U-2H], 5%
sample_conditions_1: ionic strength: 50 mM; pH: 6.5; pressure: 1 atm; temperature: 288 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | ZfL2-1-34_D2O | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | ZfL2-1-34_D2O | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | ZfL2-1-34_D2O | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | ZfL2-1-34_D2O | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | ZfL2-1-34_H2O | isotropic | sample_conditions_1 |
| 2D 1H-13C TROSY | ZfL2-1-34_D2O | isotropic | sample_conditions_1 |
| 2D 1H-13C TROSY | ZfL2-1-34_D2O | anisotropic | sample_conditions_1 |
TOPSPIN v2.1, Bruker Biospin - collection, processing
CNSSOLVE v1.3, Brunger, Adams, Clore, Gros, Nilges and Read - refinement, structure solution
SPARKY v3.114, Goddard - peak picking
X-PLOR_NIH v2.32, Schwieters, Kuszewski, Tjandra and Clore - grid search