Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30258
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Shortridge, M.; Walker, M.; Pavelitz, T.; Chen, Y.; Yang, W.; Varani, G.. "A macrocyclic peptide ligand binds the oncogenic microRNA-21 precursor and suppresses Dicer processing.
" ACS Chem. Biol. 12, 1611-1620 (2017).
PubMed: 28437065
Assembly members:
entity_1, polymer, 31 residues, 9912.896 Da.
entity_2, polymer, 14 residues, 1812.225 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGUGUUGACUGUUGAAUCUC
AUGGCAACACC
entity_2: RVRTRGKRRIRRXP
| Data type | Count |
| 15N chemical shifts | 13 |
| 1H chemical shifts | 244 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
| 2 | entity_2 | 2 |
Entity 1, entity_1 31 residues - 9912.896 Da.
| 1 | G | G | U | G | U | U | G | A | C | U | ||||
| 2 | G | U | U | G | A | A | U | C | U | C | ||||
| 3 | A | U | G | G | C | A | A | C | A | C | ||||
| 4 | C |
Entity 2, entity_2 14 residues - 1812.225 Da.
| 1 | ARG | VAL | ARG | THR | ARG | GLY | LYS | ARG | ARG | ILE | ||||
| 2 | ARG | ARG | DPR | PRO |
sample_1: ARG-VAL-ARG-THR-ARG-GLY-LYS-ARG-ARG-ILE-ARG-ARG-DPR-PRO 0.8 mM; EDTA 10 mM; potassium phosphate 10 mM; pre-miR21 0.8 mM; sodium chloride 10 mM
sample_2: ARG-VAL-ARG-THR-ARG-GLY-LYS-ARG-ARG-ILE-ARG-ARG-DPR-PRO 1 mM; potassium phosphate 10 mM; sodium chloride 10 mM
sample_conditions_1: ionic strength: 10 mM; pH: 6.5; pressure: 1 atm; temperature: 310 K
sample_conditions_2: ionic strength: 10 mM; pH: 6.5; pressure: 1 atm; temperature: 310 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_2 | isotropic | sample_conditions_2 |
| 2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_2 |
| 2D 1H-15N HSQC | sample_2 | isotropic | sample_conditions_2 |
SPARKY, Goddard - chemical shift assignment, peak picking
X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure calculation